Skip to content

Advertisement

Open Access

Inhibitory effect of phytol on cellular senescence

Biomedical Dermatology20182:13

https://doi.org/10.1186/s41702-018-0025-8

Received: 27 September 2017

Accepted: 7 March 2018

Published: 15 April 2018

Abstract

Background

Phytol is a component of chlorophyll with demonstrated anticancer and immune-enhancing effects. In particular, it has been reported that phytol enhances the activity of natural killer cells that detect and remove cancer cells and promotes macrophage functions in immunity. In this study, based on the recently published precedent articles, we examined whether phytol can also inhibit cellular senescence to provide evidence for its possible use as a base material for cosmetics.

Methods

HaCaT keratinocytes were pretreated with phytol for 24 h and then treated with oxidative stress-inducing hydrogen peroxide (H2O2) for 6 h before the analysis; anti-inflammation analysis, cell cycle analysis, cytoprotection analysis, caspase 3 (CASP3) activity analysis, and senescence-associated β-galactosidase (SA-β-gal) assay were performed to examine the cell potency of phytol.

Results

In this study, HaCaT keratinocytes, treated with 750 μM H2O2, were tested with a phytol concentration below 10 μM to obtain the following results. First, phytol pretreatment suppressed H2O2-induced inflammation in a concentration-dependent manner, as indicated by the reduced expression of the mRNA levels of TNF-α (tumor necrosis factor-alpha), IL6 (interleukin 6), IL8 (interleukin 8), and COX2 (cyclooxygenase 2). Second, the quantitative analysis of cell cycle, NRF2 (nuclear factor erythroid 2-related factor 2), HO-1 (heme oxygenase 1), 14-3-3σ (Stratifin), cyclin B mRNA, and CASP3 was performed to examine the cytoprotective effects of phytol, as evidenced by increased mRNA expression of the cytoprotective genes NRF2 and HO-1 and decreased mRNA expression of the G2 cell cycle arrest-inducing genes 14-3-3σ and Cyclin B. CASP3, a protein that induces apoptosis, was reduced in a concentration-dependent manner, confirming that phytol protected cells from apoptosis. Third, the SA-β-gal assay revealed that phytol reduced H2O2-induced senescence in a concentration-dependent manner, and the cellular senescence was delayed on treatment using phytol.

Conclusions

This study verifies that phytol can inhibit oxidative stress-induced senescence of HaCaT keratinocytes. The results suggest the use of phytol as a base material for cosmetics to inhibit cellular senescence.

Keywords

PhytolHaCaT keratinocytesAntioxidantAnti-inflammation

Background

Oxidative stress induces both proinflammatory and cytoprotective genes. The NRF2-KEAP1 (kelch-like ECH-associated protein 1) system is one of the major intracellular mechanisms for maintaining reductive homeostasis in cells and for protecting cells from oxidative stress (Motohashi and Yamamoto 2004) (Fig. 1). Under normal physiological conditions, nuclear factor erythroid 2-related factor 2 (NRF2) resides in the cytoplasm bound to the actin-binding protein KEAP1. Under oxidative stress, however, NRF2 separates from KEAP1, becomes activated, and translocates to the nucleus where it binds to the antioxidant response element (ARE) promoter and increases the expression of antioxidant enzymes such as HO-1 (Paine et al. 2010; Kang et al. 2005). HO-1 plays an important role in regulating cellular heme levels by oxidation and degradation, which releases biliverdin, carbon monoxide, and free Fe2+. Biliverdin is then converted to the antioxidant bilirubin by cytoplasmic reductase. In addition, HO-1 is a heat shock protein that protects cells and regulates inflammation when cells are exposed to various oxidative stressors such as hypoxia–reperfusion, heavy metals, ultraviolet (UV) light, H2O2, and nitric oxide (NO) (Marcinkiewicz et al. 2006; Black et al. 2008).
Fig. 1

Nrf2-antioxidant response element signaling pathway

The P53 (tumor protein P53) acts as an “emergency brake” for the cell cycle and determines whether cells damaged by reactive oxygen species (ROS) are repaired or proceed to apoptosis. If the P53 gene does not function properly, cells will replicate uncontrollably to form tumors. The P53 protein regulates the expression levels of various cell cycle-related genes such as cyclin-dependent kinase inhibitor 1A (P21), 14-3-3σ, and CASP3 (Kortlever et al. 2006). In particular, P21 promotes G1 cell cycle arrest, 14-3-3σ and cyclin B promote G2 cell cycle arrest, and CASP3 triggers cellular apoptosis (Brown et al. 1997; El-Deiry 1998) (Fig. 2).
Fig. 2

Modeling of p53 pathway to cell cycle arrest and apoptosis

Phytol (C20H40O, molecular weight 296.5) is a component of chlorophyll that is known to be a strong cytoprotectant against oxidative stress. It is found at high levels in perilla leaves and shepherd’s purse and is produced by chlorophyll hydrolysis upon destruction of plant tissue (Gross 1991). Phytol is known to have strong anticancer and immune-enhancing properties. Phytol not only enhances the activity of natural killer cells that remove cancer cells but also strengthens immunity by regulating macrophage function (Park 1978). Indeed, most recent research on phytol has focused on these anticancer and anti-inflammatory properties (Komiya et al. 1999; Silva et al. 2014). In contrast, few studies have evaluated the potential anti-senescence efficacy of phytol, a property desirable for antiaging products. Therefore, we examined the cytoprotective and anti-senescence effects of phytol to evaluate it suitability as a base material for cosmetics.

Methods

Cell culture

The human keratinocyte cell line HaCaT was purchased from the American Type Culture Collection (Manassas, VA, USA) for this study. Cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM; Hyclone™, GE Healthcare Life Sciences, Little Chalfont, Bucks, UK) supplemented with 10% fetal bovine serum (FBS; Hyclone™) and 1% penicillin/streptomycin (penicillin 100 IU/mL, streptomycin 100 μg/mL; Invitrogen™, Thermo Fisher Scientific, Waltham, MA, USA) at 37 °C under a 5% CO2 atmosphere.

Cell viability analysis

The water-soluble tetrazolium salt (WST-1) assay was performed to evaluate the cytotoxicity of phytol and H2O2 in HaCaT keratinocytes. Phytol was purchased in pure powder form (> 97%, Sigma-Aldrich, St. Louis, Mo, USA) and dissolved in dimethyl sulfoxide (DMSO; Sigma-Aldrich) before use. HaCaT cells (3 × 103 cells/well) were cultured on 96-well plates for 24 h and treated with phytol at 1, 2, 5, 10, and 20 μM for 24 h. Cells were then treated with 10 μL EZ-Cytox cell viability assay kit reagent (ItsBio, Seoul, Korea) and incubated for 6 h. Absorbance was measured at 490 nm on a microplate reader (Bio-Rad, Hercules, CA, USA). Each trial was repeated three times to obtain the mean and standard deviation of cell viability.

qRT-PCR analysis

After the indicated treatments, cells were dissolved in Trizol reagent (Invitrogen™) and cellular RNA was isolated by addition of 0.2 mL chloroform (Biopure, Tulln, Austria). The mRNA was dissolved in diethylpyrocarbonate (DEPC; Biopure) water for use in quantitative real-time polymerase chain reaction (qRT-PCR) assays. Only highly pure mRNA samples were used for qRT-PCR, as indicated by an 260/280 nm ratio ≥ 1.8 measured in a Nanodrop cuvette (Maestrogen, Hsinchu, Taiwan). PCR was validated via melting curve analysis, and the expression of each gene of interest was compared after standardization with respect to the expression of β-actin. All primers used are listed in Table 1.
Table 1

List of primers

Gene (symbol)

Forward primer

Reverse primer

β-actin

GGATTCCTATGTGGGCGACGA

CGCTCGGTGAGGATCTTCATG

14-3-3σ

GTGTGTCCCCAGAGCATGG

ACCTTCTCCCGGTACTCACG

TNF-α

CCCAGGGACCTCTCTCTAATC

GGTTTGCTACAACATGGGCTACA

IL6

TAACAGTTCCTGCATGGGCGGC

AGGACAGGCACAAACACGCACC

IL8

CTCTCTTGGCAGCCTTCC

CTC AATCACTCTCAGTTCTTTG

NRF2

TACTCCCAGGTTGCCCACA

CATCTACAAACGGGAATGTCTGC

HO-1

GCCTGCTAGCCTGGTTCAAG

AGCGGTGTCTGGGATGAACTA

COX2

CGCGGATCCGCGGTGAGAACCGTTTAC

GCGAGGAAGCGGAAGAGTCTAGAGTCGACC

Cyclin B

GGCCAAAATGCCTATGAAGA

AGATGTTTCCATTGGGCTTG

To examine the cytoprotective effects of phytol, the expression levels of genes related to the NRF2-ARE and P53 pathways were measured by qRT-PCR. HaCaT cells (2 × 105 cells/well) were cultured for 24 h in 60-mm culture dishes and then pretreated with culture medium containing vehicle or 1, 5, or 10 μM phytol for 24 h. After washing with PBS, cells were treated with 750 μM H2O2 for 6 h, and the expression levels of NRF2, HO-1, 14-3-3σ, and Cyclin B mRNAs were measured.

Cell cycle analysis

Cell cycle was analyzed by measuring the cell numbers in G0/G1, S, and G2/M stages using a BD FACSCalibur™ flow cytometer (BD Biosciences, San Jose, CA, USA). Cells were seeded on 60-mm culture dishes at 2 × 105 cells/well, incubated for 24 h, and then pretreated with vehicle or phytol (1, 5, or 10 μM) for 24 h. After washing with PBS, 750 μM H2O2 was added for 6 h. Cells were then harvested and centrifuged at 5000 rpm for 5 min at 4 °C. The supernatant was removed, and 300 μL phosphate buffered saline (PBS) was added to resuspend the cell pellet. Then, 700 μL absolute ethanol was gradually added while vortexing. The cells were then frozen and stored at 4 °C for at least 3 h for immobilization, after which 1 mL PBS was added, and the supernatant was removed by centrifugation at 5000 rpm for 5 min at 4 °C. Cells were then resuspended in 200 μL propidium iodide (PI) staining buffer (Sigma-Aldrich) and allowed to stand at 37 °C for 1 h. HaCaT cells were centrifuged at 5000 rpm for 5 min at 4 °C to remove excess staining buffer, washed with PBS, and resuspended in 1 mL PBS. The number of cells in each cell cycle stage was measured using a BD FACSCalibur™ flow cytometer.

Quantitative analysis of CASP3 activity

The ApoAlert™ caspase-3 colorimetric assay kit (Takara Bio, Shiga, Japan) was used to examine the expression of CASP3, which induces apoptosis. HaCaT cells were seeded in 60-mm culture dishes at 2 × 105 cells/well for 24 h and then pretreated with vehicle or 1, 5, or 10 μM phytol for an additional 24 h. After PBS washing, cells were treated with 750 μM H2O2 for 6 h. The cell pellet was isolated as described above and resuspended in chilled cell lysis buffer, left on ice for 10 min, and centrifuged at 15,000 rpm for 3 min at 4 °C. The supernatant was added to 96-well plates containing ApoAlert™ reaction buffer and incubated at 37 °C for 30 min. Caspase-3 substrate was then added, the mixture was incubated for 1 h at 37 °C, and the absorbance was measured at 405 nm on a microplate reader (Bio-Rad).

Cell senescence analysis

The effect of phytol on cell senescence was examined using SA-β-gal detection kit (BioVision, Milpitas, CA, USA). HaCaT cells were seeded on 60-mm dishes at 2 × 105 cells/well, cultured for 24 h, pretreated with vehicle or phytol at 1, 5, or 10 μM for 24 h, and then with 750 μM H2O2. Keratinocytes were then removed from the medium, washed with 1 mL PBS, and fixed with 0.5 mL fixing solution at room temperature for 15 min. The fixed cells were incubated in 0.5 mL staining mixture containing 470 μL staining solution, 5 μL staining supplement, and 25 μL X-gal in dimethylformamide (DMF; 20 mg/mL) at 37 °C for 24 h. Cells were washed with PBS and the number of stained cells to the total was measured using an optical microscope (Olympus, Tokyo, Japan).

Statistics

All experiments in this study were conducted at least three times on separate cultures. Group means were compared by paired t tests. A p value of ≤ 0.05 was considered statistically significant.

Results

Cytotoxicities of phytol and H2O2

The WST-1 assay was performed to determine the cytotoxicities of phytol and H2O2 on HaCaT keratinocytes. Cell viability was 101% at 1, 106% at 2, 114% at 5, 109% at 10, and 103% at 20 μM phytol compared with the vehicle-treated control group, indicating that phytol alone is non-toxic to HaCaT cells at the concentrations used. Concentrations of 1, 5, and 10 μM were chosen for subsequent experiments (Fig. 3a). In contrast, cell viability was 98% at 100, 92% at 250, 85% at 500, 76% at 750, and 59% at 1000 μM H2O2 compared with the untreated control group. Due to the robust but not excessive cell death at this concentration, 750 μM H2O2 was chosen for subsequent experiments (Fig. 3b).
Fig. 3

Cytotoxicity of phytol and H2O2 in HaCaT keratinocytes. Cell viability of phytol (a) and H2O2 (b) on HaCaT cells was tested by performing WST-1 assay. The HaCaT (3 × 103 cells/well) were seeded on 96-well plates. Phytol and H2O2 were treated with each of indicated concentrations for 24 and 6 h. The data are expressed as means ± standard deviation from three independent experiments (*p < 0.05)

Anti-inflammatory effects of phytol

To examine the potential anti-inflammatory effects of phytol on HaCaT keratinocytes, the expression levels of proinflammatory genes were compared among control, H2O2-treated, and phytol-pretreated/H2O2-treated cultures. Treatment with H2O2 alone increased TNF-α mRNA expression by approximately 4.3-fold compared with untreated controls, whereas pretreatment with phytol markedly reduced this H2O2-induced response to 4.0-fold at 1, 2.5-fold at 5, and to 1.1-fold at 10 μM. This concentration-dependent decrease in TNF-α mRNA expression indicates that phytol has anti-inflammatory effects against H2O2 (Fig. 4a). Furthermore, H2O2 alone enhanced IL6 mRNA expression by 6.7-fold and IL8 mRNA expression by 8.7-fold compared with the untreated controls, whereas phytol pretreatment reduced the H2O2-induced IL6 expression to 5.2-fold at 1, 3.8-fold at 5, and to 1.9-fold at 10 μM and IL8 mRNA expression to 6.0-fold at 1, 4.0-fold at 5, and 3.2-fold at 10 μM (Fig. 4b, c). Finally, phytol reduced COX2 mRNA upregulation induced by H2O2 alone to 0.91-fold at 1, 0.74-fold at 5, and 0.66-fold at 10 μM. Collectively, these results indicate that phytol is a potent suppressor of the H2O2-induced inflammatory responses (Fig. 4d).
Fig. 4

Anti-inflammatory effect of phytol in HaCaT keratinocytes. HaCaT (2 × 105 cells/well) were seeded and then treated with the indicated concentrations of phytol for 24 h. Then, the cells were washed with PBS and exposed to H2O2 for 6 h. Expression of TNF-α (a), IL6 (b), IL8 (c), and COX2 (d) mRNA was determined using the qRT-PCR. The data are expressed as means ± standard deviation from three independent experiments (*p < 0.05)

Cell cycle recovery by phytol

Analysis of cell cycle progression in HaCaT keratinocytes using fluorescence-activated cell sorting indicated that H2O2-treated cells aged more rapidly than the untreated control cells, as evidenced by a decreased proportion of HaCaT cells in the G0/G1 phase. Pretreatment with phytol (1, 5, and 10 μM) dose-dependently increased the proportion of H2O2-treated cells in the G0/G1 phase (Fig. 5). Therefore, phytol reversed the suppressive effect of H2O2 on cell cycle progression.
Fig. 5

Effect of phytol on cell cycle distribution by flow cytometry in HaCaT keratinocytes. Restoration of cell cycle arrest by phytol in H2O2-treated HaCaT keratinocytes was tested. HaCaT (2 × 105 cells/well) were seeded and then treated with the indicated concentrations of phytol for 24 h. Then, the cells were washed with PBS and exposed to H2O2 for 6 h. After further incubation for 24 h, cell cycle was determined using the PI staining and BD FACSCalibur™ flow cytometer (*p < 0.05)

Cytoprotection by phytol through the NRF2-ARE signaling pathway

To examine if phytol can initiate a cytoprotective response against oxidative stress, the expression of NRF2 mRNA was measured by qRT-PCR. The expression of NRF2 mRNA was reduced 0.7-fold by H2O2 compared with the control group, whereas pretreatment with phytol increased the expression to 0.9-fold at 1, 1.4-fold at 5, and 1.6-fold at 10 μM, verifying its cytoprotective efficacy (Fig. 6a). The expression of HO-1 mRNA was increased 7.9-fold by H2O2 alone compared with the control group, and phytol pretreatment enhanced this protective response, increasing the expression to 9.2-fold at 1, 11.8-fold at 5, and 16.6-fold at 10 μM (Fig. 6b).
Fig. 6

Protective effect of phytol via NRF2-ARE pathway in HaCaT keratinocytes. HaCaT (2 × 105 cells/well) were seeded and then treated with the indicated concentrations of phytol for 24 h. Then, the cells were washed with PBS and exposed to H2O2 for 6 h. Expression of NRF2 (a) and HO-1 (b) mRNA was determined using the qRT-PCR. The data are expressed as means ± standard deviation from three independent experiments (*p < 0.05)

Cytoprotective effect of phytol through suppression of P53 target genes

Cyclin B and 14-3-3σ are downstream targets of P53 known to arrest the cell cycle at G2. To investigate the cytoprotective efficacy of phytol via the P53 pathway, the mRNA expression levels of 14-3-3σ and Cyclin B were examined in HaCaT keratinocytes. The expression level of 14-3-3σ mRNA increased 3.1-fold and Cyclin B mRNA by 4.6-fold in H2O2-treated cells compared with untreated controls, whereas phytol pretreatment reduced 14-3-3σ mRNA expression to 2.8-fold at 1, 1.5-fold at 5, and 0.9-fold (below baseline) at 10 μM and Cyclin B mRNA expression to 3.2-fold at 1, 2.0-fold at 5, and 1.2-fold at 10 μM, indicating substantial cytoprotective efficacy via P53 signaling (Fig. 7a, b).
Fig. 7

Protective effect of phytol via P53 pathway in HaCaT keratinocytes. HaCaT (2 × 105 cells/well) were seeded and then treated with the indicated concentrations of phytol for 24 h. Then, the cells were washed with PBS and exposed to H2O2 for 6 h. The expression of 14-3-3σ (a) and Cyclin B (b) mRNA was determined using the qRT-PCR. The data are expressed as means ± standard deviation from three independent experiments (*p < 0.05)

Cytoprotective effect of phytol through inhibition of CASP3 activity

Caspases are involved in mediating cellular apoptosis signaling and directly degrading intracellular proteins (Riedl and Shi, 2004). CASP3 activity was measured to examine if phytol protects H2O2-treated HaCaT keratinocytes by suppressing apoptosis. Treatment with H2O2 alone increased CASP3 expression by 12.7-fold compared with the phytol and H2O2 untreated groups, whereas phytol pretreatment reduced this increase to 9.6-fold at 1, 5.8-fold at 5, and 4.1-fold at 10 μM, suggesting that cytoprotection by phytol is mediated in part by the suppression of apoptosis (Fig. 8).
Fig. 8

Effect of phytol on levels of activated CASP3 in HaCaT keratinocytes. HaCaT (2 × 105 cells/well) were seeded and then treated with the indicated concentrations of phytol for 24 h. Then, the cells were washed with PBS and exposed to H2O2 for 6 h. After further incubation for 6 h, level of activated CASP3 was determined using the CASP3 assay. The data are expressed as means ± standard deviation from three independent experiments (*p < 0.05)

Inhibitory effect of phytol on cellular senescence

In HaCaT keratinocytes, the expression ratio of SA-β-gal was 8% in phytol and H2O2 untreated control groups but was markedly increased to 87% by H2O2. However, the ratio of SA-β-gal decreased in a concentration-dependent manner to 49% at 1, 38% at 5, and 21% at 10 μM phytol, indicating that phytol can suppress cellular senescence induced by oxidative stress (Fig. 9).
Fig. 9

Effect of phytol on senescence using SA-β-gal assay in HaCaT keratinocytes. HaCaT (2 × 105 cells/well) were seeded and then treated with the indicated concentrations of phytol for 24 h. Then, the cells were washed with PBS and exposed to H2O2 for 6 h. Cellular senescence by phytol was determined using the SA-β-gal assay. The data are expressed as mean ± standard deviation from three independent experiments (*p < 0.05)

Discussion

HaCaT keratinocytes were pretreated with phytol for 24 h and then treated with oxidative stress-inducing H2O2 for 6 h. Effects on inflammation, cell cycle, cytoprotective signals, CASP3, and senescence were assessed. The following results were obtained.

Firstly, phytol suppressed the H2O2-induced increases in mRNA expression levels of the inflammatory genes TNF-α, IL6, IL8, and COX2 in a concentration-dependent manner. Environmental stressors such as ROS and foreign antigens induce the expression of proinflammatory cytokines and enzymes such as TNF-α, IL6, IL8, and COX2. TNF-α is produced mainly by macrophages and T lymphocytes in response to microbial infection, and it is involved in various inflammatory responses through activation of the stress-related transcription factor NF-κB (nuclear factor kappa B) (Wajant et al. 2003). The multi-functional cytokines IL6 and IL8 are known to mediate inflammatory and immune responses (Pang et al. 1994; Zhai et al. 2001). The amount of COX2 is increased in inflamed and cancerous tissues when stimulated by various growth factors, cytokines, tumor promoters, or TNF-α (Masferrer et al. 1994).

Secondly, the quantitative analysis of cell cycle, NRF2, HO-1, 14-3-3σ, Cyclin B mRNA, and CASP3 to confirm the cytoprotective effect of phytol revealed that the mRNA expression levels of cytoprotective genes, NRF and HO-1, increased, whereas those of the G2 cell cycle arrest-inducing genes, 14-3-3σ and Cyclin B, decreased, confirming the recovery of the cytoprotective effect by phytol. CASP3, a protein inducing apoptosis, decreased in a concentration-dependent manner, confirming that phytol protected cells from apoptosis.

The transcription factor NRF2 coordinates cellular defenses against oxidative stress by inducing antioxidant genes. Under non-stressed conditions, NRF2 exists in an inactive cytoplasmic form bound to KEAP1, an intracellular sensor of oxidative stress. Upon induction of oxidative stress, NRF2 separates from KEAP1 and translocates into the nucleus through phosphorylation, where it binds to ARE elements in the promoters of antioxidant genes such as HO-1 (Itoh et al. 1999; Niture et al. 2009). HO-1 plays a protective role in maintaining cell homeostasis under various stresses in the environment. The protein HO-1 is widely expressed throughout the body and is induced when cells are exposed to various types of oxidative stressors such as hypoxia–reperfusion, heavy metals, high temperature, UV, and ROS (Marcinkiewicz et al. 2006; Black et al. 2008). The aging process is characterized by progressive oxidation and damage of cellular components partly due to the reduced expression of antioxidant defense system components, particularly genes under the control of the NRF2-ARE signaling pathway.

Cell replication, which is one of the most important characteristics of cells, proceeds through a tightly regulated series of steps comprising the cell cycle. Tissues maintain proper function and systemic homeostasis through cell cycle control or apoptosis, which allows each tissue to control cell number (Martinsoon et al. 1994). This process can be mainly divided into replication and division. The cell cycle comprises the G1 phase to prepare for growth and chromosomal replication, the S phase to clone chromosomes, the G2 phase to prepare for division, and the M phase of division. In addition, there is a G0 phase, in which cells no longer divide or participate in the cell cycle, i.e., differentiated cells that do not divide forever eventually pass from the G1 phase to the G0 phase. This transition from one stage to the next is characterized by checkpoints (Hartwell and Weinert 1989). The most important factors regulating the cell cycle are cyclin and cyclin-dependent kinase, which are responsible for the initiation, progression, and completion of the cell cycle (Nurse 1994). These cell cycle factors determine whether to repair cell damage or induce apoptosis. Analysis of cell cycle progression in HaCaT keratinocytes using fluorescence-activated cell sorting indicated that H2O2-treated cells aged more rapidly than the untreated control cells. Pretreatment with phytol dose-dependently increased the proportion of H2O2-treated cells in the G0/G1 phase. Therefore, phytol reversed the suppressive effect of H2O2 on cell cycle progression.

Thirdly, the SA-β-gal cell aging assay showed that the concentration of SA-β-gal decreased in a concentration-dependent manner, confirming that the cellular senescence was delayed on treatment using phytol. Cellular senescence stops the cell cycle and changes the cell state (Collado et al. 2007; Kuilman et al. 2010). Cellular senescence is thought to underlie aging because the body loses the capacity of tissue repair (Campisi 2007). The SA-β-gal assay, which is based on the observation that β-gal activity detected at pH 6.0 increases as the cell enters senescence, was used to examine if phytol could promote cellular senescence recovery in response to oxidative stress.

Conclusions

In this study, the effect of phytol on the inhibition of cellular senescence in HaCaT keratinocytes was studied. Phytol is a component of chlorophyll, a green pigment in plant tissues, and has strong anticancer and immune-enhancing effects. It is known that this substance not only enhances the activity of natural killer cells that detect and remove cancer cells but also enhances immunity through macrophage function. Based on recently published articles related to anticancer and anti-inflammation efficacies, we tested the anti-senescence efficacy of phytol to determine its suitability as a base material for cosmetics.

In this study, phytol was shown to inhibit cellular senescence from H2O2-induced oxidative stress. These results suggest the possibility of use of phytol as a base material for cosmetics base material to inhibit cellular senescence.

Abbreviations

14-3-3σ: 

Stratifin

ARE: 

Antioxidant response element

CASP3: 

Caspase 3

COX2: 

Cyclooxygenase 2

DEPC: 

Diethylpyrocarbonate

DMEM: 

Dulbecco’s modified Eagle’s medium

DMF: 

Dimethylformamide

DMSO: 

Dimethyl sulfoxide.

FBS: 

Fetal bovine serum

H2O2

Hydrogen peroxide

HO-1: 

Heme oxygenase 1

IL6: 

Interleukin 6

IL8: 

Interleukin 8

KEAP1: 

Kelch-like ECH-associated protein 1

NF-κB: 

Nuclear factor kappa B

NO: 

Nitric oxide

NRF2: 

Nuclear factor erythroid 2-related factor 2

P21: 

Cyclin dependent kinase inhibitor 1A

P53: 

Tumor protein P53

PBS: 

Phosphate buffered saline

PI: 

Propidium iodide

qRT-PCR: 

Quantitative real-time polymerase chain reaction

ROS: 

Reactive oxygen species

SA-β-gal: 

Senescence-associated β-galactosidase

TNF-α: 

Tumor necrosis factor-alpha

UV: 

Ultraviolet

WST-1: 

Water-soluble tetrazolium salt

Declarations

Acknowledgements

Not applicable.

Funding

Not applicable.

Availability of data and materials

Not applicable.

Authors’ contributions

SH did all of the research background such as the experiments, data collection, and statistical analysis as well as drafted the manuscript. The author read and approved the final manuscript.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare that there are no competing interests.

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Beauty and Art, Suwon Women’s University, Suwon-si, Republic of Korea

References

  1. Black AT, Gray JP, Shakarjian MP, Laskin DL, Heck DE, Laskin JD. Distinct effects of ultraviolet B light on antioxidant expression in undifferentiated and differentiated mouse keratinocytes. Carcinogenesis. 2008;29:219–25.View ArticlePubMedGoogle Scholar
  2. Brown JP, Wei W, Sedivy JM. Bypass of senescence after disruption of p21CIP1/WAF1 gene in normal diploid human fibroblasts. Science. 1997;277:831–4.View ArticlePubMedGoogle Scholar
  3. Campisi J, d'Adda di Fagagna F. Cellular senescence: when bad things happened to good cells. Nat Rev Mol Cell Biol. 2007;8:729–40.View ArticlePubMedGoogle Scholar
  4. Collado M, Blasco MA, Serrano M. Cellular senescence in cancer and aging. Cell. 2007;130:223–33.View ArticlePubMedGoogle Scholar
  5. El-Deiry WS. p21/p53, cellular growth control and genomic integrity. Curr Top Microbiol Immunol. 1998;227:121–37.PubMedGoogle Scholar
  6. Gross J. Pigments in vegetable. New York: Springer; 1991. p. 29–30.View ArticleGoogle Scholar
  7. Hartwell LH, Weinert TA. Checkpoints: controls that ensure the order of cell cycle events. Science. 1989;246:629–34.View ArticlePubMedGoogle Scholar
  8. Itoh K, Wakabayashi N, Katoh Y, Ishii T, Igarashi K, Engel JD, et al. Keap 1 represses nuclear activation of antioxidant responsive elements by Nrf2 through binding to the amino-terminal Neh2 domain. Genes Dev. 1999;13:76–86.View ArticlePubMedPubMed CentralGoogle Scholar
  9. Kang KW, Lee SJ, Kim SG. Molecular mechanism of Nrf2 activation by oxidative stress. Antioxid Redox Signal. 2005;7:1664–73.View ArticlePubMedGoogle Scholar
  10. Komiya T, Kyohkon M, Ohwaki S, Eto J, Katsuzaki H, Imai K, et al. Phytol induces programmed cell death in human lymphoid leukemia Molt 4B cells. Int Mol Med. 1999;4:377–80.Google Scholar
  11. Kortlever RM, Higgins PJ, Bernards R. Plasminogen activator inhibitor-1 is a critical downstream target of p53 in the induction of replicative senescence. Nat Cell Biol. 2006;8:877–84.View ArticlePubMedPubMed CentralGoogle Scholar
  12. Kuilman T, Michaloglou C, Mooi WJ, Peeper DS. The essence of senescence. Genes Dev. 2010;24:2463–79.View ArticlePubMedPubMed CentralGoogle Scholar
  13. Marcinkiewicz J, Kurnyta M, Biedroń R, Bobek M, Kontny E, Maśliński W. Anti-inflammatory effects of taurine derivatives (taurine chloramine, taurine bromamine, and taurolidine) are mediated by different mechanisms. Adv Exp Med Biol. 2006;583:481–92.View ArticlePubMedGoogle Scholar
  14. Martinsoon HS, Starborg M, Erlandsson F, Zetterberg A. Single cell analysis of G1 check points-the relationship between the restriction point and phosphorylation of pRb. Exp Cell Res. 2005;305:383-91Nurse P. Ordering of S phase and M phase in the cell cycle. Cell 1994;79:547–550.Google Scholar
  15. Masferrer JL, Zweifel BS, Manning PT, Hauser SD, Leahy KM, Smith WG, et al. Selective inhibition of inducible cyclooxygenase 2 in vivo is antiinflammatory and nonulcerogenic. Proc Natl Acad Sci U S A. 1994;91:3228–32.View ArticlePubMedPubMed CentralGoogle Scholar
  16. Motohashi H, Yamamoto M. Nrf2-Keap1 defines a physiologically important stress response mechanism. Trends Mol Med. 2004;10:549–57.View ArticlePubMedGoogle Scholar
  17. Niture SK, Jain AK, Jaiswal AK. Antioxidant-induced modification of INrf2 cysteine 151 and PKC-delta-mediated phosphorylation of Nrf2 serine 40 are both required for stabilization and nuclear translocation of Nrf2 and increased drug resistance. J Cell Sci. 2009;122:4452–64.View ArticlePubMedPubMed CentralGoogle Scholar
  18. Nurse P. Ordering of S phase and M phase in the cell cycle. Cell. 1994;79:547–50.View ArticlePubMedGoogle Scholar
  19. Paine A, Eiz-Vesper B, Blasczyk R, Immenschuh S. Signaling to heme oxygenase-1 and its anti-inflammatory therapeutic potential. Biochem Pharmacol. 2010;80:1895–903.View ArticlePubMedGoogle Scholar
  20. Pang G, Couch L, Batey R, Clancy R, Cripps A. CM-CSF, IL-1 alpha, IL-beta, IL-6, IL-8, IL-10, ICAM-1 and VCAM-1 gene expression and cytokine production in human duodenal fibroblasts stimulated with lipopolysaccharide, IL-1 alpha and TNF-alpha. Clin Exp Immunol. 1994;96:437–43.View ArticlePubMedPubMed CentralGoogle Scholar
  21. Park CS. Studies on the mineral contents in Korean foods: V. sodium and potassium contents in vegetables. Duksung Women’s University. Journal. 1978;7:299–311.Google Scholar
  22. Riedl SJ, Shi Y. Molecular mechanisms of caspase regulation during apoptosis. Nat Rev Mol Cell Biol. 2004;5:897–907.View ArticlePubMedGoogle Scholar
  23. Silva RO, Sousa FBM, Damasceno SRB, Carvalho NS, Silva VG, Oliveria FRMA, et al. Phytol, a diterpene alcohol, inhibits the inflammatory response by reducing cytokine production and oxidative stress. Fundam Clin Pharmacol. 2014;28:455–64.View ArticlePubMedGoogle Scholar
  24. Wajant H, Pfizenmaier K, Scheurich P. Tumor necrosis factor signaling. Cell Death Differ. 2003;10:45–65.View ArticlePubMedGoogle Scholar
  25. Zhai R, Liu G, Yang C, Huang C, Wu C, Christiani DC. The G to C polymorphism at -174 of the interleukin-6 gene is rare in a Southern Chinese population. Pharmacogenetics. 2001;11:699–701.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s) 2018

Advertisement