Skip to main content

Table 1 List of primers

From: Inhibitory effect of phytol on cellular senescence

Gene (symbol) Forward primer Reverse primer
β-actin GGATTCCTATGTGGGCGACGA CGCTCGGTGAGGATCTTCATG
14-3-3σ GTGTGTCCCCAGAGCATGG ACCTTCTCCCGGTACTCACG
TNF-α CCCAGGGACCTCTCTCTAATC GGTTTGCTACAACATGGGCTACA
IL6 TAACAGTTCCTGCATGGGCGGC AGGACAGGCACAAACACGCACC
IL8 CTCTCTTGGCAGCCTTCC CTC AATCACTCTCAGTTCTTTG
NRF2 TACTCCCAGGTTGCCCACA CATCTACAAACGGGAATGTCTGC
HO-1 GCCTGCTAGCCTGGTTCAAG AGCGGTGTCTGGGATGAACTA
COX2 CGCGGATCCGCGGTGAGAACCGTTTAC GCGAGGAAGCGGAAGAGTCTAGAGTCGACC
Cyclin B GGCCAAAATGCCTATGAAGA AGATGTTTCCATTGGGCTTG