Skip to main content

Table 1 Primers used in Q-PCR

From: Temporal changes in the cell population and wound healing-related gene expression in deep partial-thickness burn wound model

S. no.GenePrimer
1IL-6Forward: 5′ -CCCTTCAGGAACAGCTATGAA- 3’
Reverse:5′ -ACAACATCAGTCCCAAGAAGG- 3’
2TNF-αForward: 5′ -GCCTCTTCTCATTCCTGCTC- 3’
Reverse: 5′ -GAGCCCATTTGGGAACTTCT- 3’
3iNOSForward: 5′ -CAGGTTGAGGATTACTTCTTCCA- 3’
Reverse: 5′ -TGTCAGAGTCTTGTGCCTTTG- 3’
4VEGF-AForward: 5′ -CGGAGAGCAACGTCACTATG- 3’
Reverse: 5 ‘-TGGTCTGCATTCACATCTGC- 3’
5TGF-β1Forward: 5′ -CCTGGAAAGGGCTCAACAC −3’
Reverse: 5′ -CAGTTCTTCTCTGTGGAGCTGA- 3’
6MMP-2Forward: 5′ -TTCTGTCCCGACCAAGGA- 3’
Reverse: 5′ -GGTGTAGATAGGGGCCATCA- 3’
7TIMP-2Forward: 5′ -CGTTTTGCAATGCAGACGTA- 3’
Reverse: 5′ -GATGGGGTTGCCATAGATGT- 3’
8Collagen-1Forward: 5′ -CAACAAGCATGTCTGGTTAGGA-3’
Reverse: 5′ -CACCCCTTCTGCGTTGTATT- 3’
9EGFRForward: 5′ -TCCATCCTAGAGAAAGGAGAGC-3’
Reverse: 5′ -GCGGCTATCAGCATCTATCAT-3’
10PGK1Forward: 5′ -GATGGGCTTGGACTGTGGTA- 3’
Reverse: 5′ -AACAGGACCGTTCCAAACAA- 3’
11PSMB2Forward: 5′ -GAGGGCAGTGGAGCTTCTTA- 3’
Reverse: 5′ -AGGTGGGCAGATTCAAGATG- 3’
12GAPDHForward: 5′-AATGTATCCGTTGTGGATCTGA - 3’
Reverse: 5′ - GCTTCACCACCTTCTTGATGT - 3’