Skip to main content

Table 1 Primer sequences used for RT-PCR

From: Effects of Helichrysum bracteatum flower extracts on UVB irradiation-induced inflammatory biomarker expression

GeneForward primer (5’ → 3’)Reverse primer (5’ → 3’)
GAPDHATTGTTGCCATCAATGACCCAGTAGAGGCAGGGATGATGT
IL-6ATGAACTCCTTCTCCACAAGCGCGAAGAGCCCTCAGGCTGGACTG
TNF-αCATTCTGGGAGGGGTCTTCCGGTTGAGGGTGTCTGAAGGA
COX-2TTCAAATGAGATTGTGGGAAAATAGATCATCTCTGCCTGAGTATCTT