Skip to main content

Table 1 Lists of primers used in this study

From: Anti-apoptotic, antioxidant and anti-aging effects of 6-shogaol on human dermal fibroblasts

Gene Forward primer Reverse primer
β-actin GGATTCCTATGTGGGCGACGA CGCTCGGTGAGGATCTTCATG
COL1A1 AGGGCCAAGACGAAGACATC AGATCACGCATCGCACAACA
MMP1 GGGCTTAGATCATTCCTCAGTGCC CAGGGTGACACCAGTGACTGCAC
SOD1 GGGAGATGGCCCAACTACTG CCAGTTGACATGCAACCGTT
CAT ATGGTCCATGCTCTCAAACC CAGGTCATCCAATAGGAAGG
NRF2 TACTCCCAGGTTGCCCACA CATCTACAAACGGGAATGTCTGC
BAX CCCTTTTCTACTTTGCCAGCAA CCCGGAGGAAGTCCAATGT
Caspase-3 TTTGAGCCTGAGCAGAGACATG TACCAGT GCGTATGGAGAAATGG
Caspase-9 CCGTGGACATTGGTTCTG TCTTGGCAGTCAGGTCGTT