Skip to main content

Table 1 Lists of primers

From: Inhibitory effect of naringenin on LPS-induced skin senescence by SIRT1 regulation in HDFs

Gene Forward primer Reverse primer
β-actin GGATTCCTATGTGGGCGACGA CGCTCGGTGAGGATCTTCATG
SIRT1 GCAGGTTGCGGGAATCCAA GGCAAGATGCTGTTGCAAA
MMP1 TCTGACGTTGATCCCAGAGAGCAG CAGGGTGACACCAGTGACTGCAC
MMP3 ATTCCATGGAGCCAGGCTTTC CATTTGGGTCAAACTCCAACTGTG
HO-1 GCCTGCTAGCCTGGTTCAAG AGCGGTGTCTGGGATGAACTA