Skip to main content

Table 1 Lists of primers used in this study

From: Anti-inflammatory and anti-aging effects of hydroxytyrosol on human dermal fibroblasts (HDFs)

Gene Forward primer Reverse primer
β-actin GGATTCCTATGTGGGCGACGA CGCTCGGTGAGGATCTTCATG
MMP1 GGGCTTAGATCATTCCTCAGTGCC CAGGGTGACACCAGTGACTGCAC
MMP3 GAGAGCAGAAGACCGAAAGGA CACAACACCACGTTATCGGG
IL-1β GATCCATTCTCCAGCTGCA CAACCAAGTATTCTCCATG
IL-6 TAACAGTTCCTGCATGGGCGGC AGGACAGGCACAAACACGCACC
IL-8 CTCTCTTGGCAGCCTTCC CTCAATCACTCTCAGTTCTTTG