Skip to main content

Table 1 List of primers used in this study

From: Anti-inflammatory effects of prunin on UVB-irradiated human keratinocytes

Gene Forward primer Reverse primer
β-actin GGATTCCTATGTGGGCGACGA CGCTCGGTGAGGATCTTCATG
TNF-α CCCAGGGACCTCTCTCTAATC GGTTTGCTACAACATGGGCTACA
IL-6 TAACAGTTCCTGCATGGGCGGC AGGACAGGCACAAACACGCACC
IL-8 CTCTCTTGGCAGCCTTCC CTC AATCACTCTCAGTTCTTTG
COX2 CGCGGATCCGCGGTGAGAACCGTTTAC GCGAGGAAGCGGAAGAGTCTAGAGTCGACC
PAR-2 GGGTTTGCCAAGTAACGGC GGGAACCAGATGACAGAGAGG