Skip to main content

Table 1 List of primers used in this study

From: Antiapoptotic effects of scutellarin on ultraviolet A-irradiated HaCaT human keratinocytes

Gene Forward primer Reverse primer
BAX CCCTTTTCTACTTTGCCAGCAA CCCGGAGGAAGTCCAATGT
B-actin GGATTCCTATGTGGGCGACGA CGCTCGGTGAGGATCTTCATG