Skip to main content

Table 1 List of primers

From: Preservation effects of geniposidic acid on human keratinocytes (HaCaT) against UVB

Gene Forward primer Reverse primer
β-actin GGATTCCTATGTGGGCGACGA CGCTCGGTGAGGATCTTCATG
P21 GTCCAGCGACCTTCCTCATCCA CCATAGCCTCTACTGCCACCATC
GADD45α GAGAGCAGAAGACCGAAAGGA CACAACACCACGTTATCGGG
SOD1 GGGAGATGGCCCAACTACTG CCAGTTGACATGCAACCGTT
SOD2 GCCCTGGAACCTCACATCAA GGTACTTCTCCTCGGTGACGTT
PCNA TAACAGTTCCTGCATGGGCGGC CGTGCAAATTCACCAGAAGGC
XPC AGCAGCTTCCCACCTGTTC GTGGGTGCCCCTCTAGTG