Skip to main content

Table 1 Lists of primers used in this study

From: Anti-inflammatory and ECM gene expression modulations of β-eudesmol via NF-κB signaling pathway in normal human dermal fibroblasts

Gene Forward primer Reverse primer
β-actin GGATTCCTATGTGGGCGACGA CGCTCGGTGAGGATCTTCATG
SOD1 GGGAGATGGCCCAACTACTG CCAGTTGACATCGAACCGTT
CAT ATGGTCCATGCTCTCAAACC CAGGTCATCCAATAGGAAGG
TNF-α CCCAGGGACCTCTCTCTAATC GGTTTGCTACAACATGGGCTACA
IL-1β GATCCATTCTCCAGCTGCA CAACCAAGTATTCTCCATG
COL1A1 AGGGCCAAGACGAAGACATC AGATCACGCATCGCACAACA
MMP1 GGGCTTAGATCATTCCTCAGTGCC CAGGGTGACACCAGTGACTGCAC
TIMP1 AACCCACCCACAGACA ACCCATGAATTTAGCCCTTA