Skip to main content

Table 1 Overview of qRT-PCR primer sequences

From: Photodamage attenuation effect by angelic acid in UVA irradiation-induced damages in normal human dermal fibroblast

Gene name (symbol) Forward primer Reverse primer
β-actin GGATTCCTATGTGGGCGACGA CGCTCGGTGAGGATCTTCATG
GPx1 TTCCCGTGCAACCAGTTTG GGACGTACTTGAGGGAATTCAGA
SOD1 GGGAGATGGCCCAACTACTG CCAGTTGACATGCAACCGTT
SOD2 GCCCTGGAACCTCACATCAA GGTACTTCTCCTCGGTGACGTT
CAT ATGGTCCATGCTCTCAAACC CAGGTCATCCAATAGGAAGG
NRF2 TACTCCCAGGTTGCCCACA CATCTACAAACGGGAATGTCTGC
HO-1 GCCTGCTAGCCTGGTTCAAG AGCGGTGTCTGGGATGAACTA
uPA CCACCAAAATGCT GTGTGCT GCTTGTCCTTCAGGGCACAT
COL1A1 AGGGCCAAGACGAAGACATC AGATCACGTCATCGCACAACA
MMP1 TCTGACGTTGATCCCAGAGAGCAG CAGGGTGACACCAGTGACTGCAC