Skip to main content

Table 1 Primers used in the qRT-PCR analyses

From: Coptis chinensis inhibits melanogenesis increasing miR-340-mediated suppression of microphathalmia-associated transcription factor

Gene Forward primer (5′ → 3′) Reverse primer (5′ → 3′)
MITF GGAACAGCAACGAGCTAAGG TGATGATCCGATTCACCAGA
Tyrosinase CAAGTACAGGGATCGGCCAAC GGTGCATTGGCTTCTGGGTAA
β-actin CCCTGTATGCCTCTGGTC GTCTTTACGGATGTCAACG